View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8551_low_8 (Length: 507)
Name: NF8551_low_8
Description: NF8551
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8551_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 6e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 6e-72
Query Start/End: Original strand, 342 - 490
Target Start/End: Original strand, 2494879 - 2495030
Alignment:
| Q |
342 |
aaacgtttgagaacaccatttgaaaaaggtgagatttttggggttgttgaggttgtgaattttgttgtgggtgtttcagtttca---tgttgttctggtg |
438 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2494879 |
aaacgtttgagaacaccatttgaaaaaggtgagatttttggggttgttgaggttgtgaattttgttgtgggtgtttcagtttcatgttgttgttctggtg |
2494978 |
T |
|
| Q |
439 |
atttagttaaggttgttgtagatgctgttaatatggttggtgctattgatgt |
490 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494979 |
atttagttaaggttgttgtagatgctgttaatatggttggtgctattgatgt |
2495030 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 137; E-Value: 3e-71
Query Start/End: Original strand, 104 - 272
Target Start/End: Original strand, 2494650 - 2494818
Alignment:
| Q |
104 |
gagtggtggctcttctggttcacggcggtgggagttacgggggcagccacaagcagcacatttttaggatgttggggcgggtggggttgctgttggggat |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||| ||| ||| ||||||||||| ||| |
|
|
| T |
2494650 |
gagtggtggctcttctggttcacggcggtggaagttacggtggcagccacaagcagcacattttaaggatgttgggtcggttggtgttgctgttggtgat |
2494749 |
T |
|
| Q |
204 |
gtcatgaattcaccacatccatctagggcatgaccacctaggtttgctgcatggtttttgagacattct |
272 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2494750 |
gtcatgaattcaccacagccatctagggcatgaccacctaggtttgctgcatggtttttgagacattct |
2494818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 195 - 272
Target Start/End: Original strand, 3684004 - 3684081
Alignment:
| Q |
195 |
gttggggatgtcatgaattcaccacatccatctagggcatgaccacctaggtttgctgcatggtttttgagacattct |
272 |
Q |
| |
|
||||| |||| ||||||||||| ||| || ||||||||||||||||||||| |||| | |||||||||||||||||| |
|
|
| T |
3684004 |
gttggtgatggcatgaattcacaacaaccgtctagggcatgaccacctagggttgccacgtggtttttgagacattct |
3684081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 206 - 272
Target Start/End: Complemental strand, 24181135 - 24181069
Alignment:
| Q |
206 |
catgaattcaccacatccatctagggcatgaccacctaggtttgctgcatggtttttgagacattct |
272 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||||||||| ||| ||||| ||||||||||||||| |
|
|
| T |
24181135 |
catgaattcaccacatccatcaagtgcatgtccacctagggatgcagcatgatttttgagacattct |
24181069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University