View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8552_high_5 (Length: 406)
Name: NF8552_high_5
Description: NF8552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8552_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 1 - 365
Target Start/End: Complemental strand, 35354722 - 35354339
Alignment:
| Q |
1 |
attgttcatatcgaatttggaatcaggggtcaggtatgtatatatgcatcactcttttt--------------gttgcatgaatccaaacacacaataag |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35354722 |
attgttcatatcgaatttggaatcaggggtcaggtatgtatatatgcatcactctttttcattgcttctttttgttgcatgaatccaaacacacaataag |
35354623 |
T |
 |
| Q |
87 |
tgcttttgttcattaaaatgtaggatgggaatgagcagcatttcaaagtgaaccaggacaagttcttgataacagcatttcaacagtactgtaaaaagat |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354622 |
tgcttttgttcattaaaatgtaggatgggaatgagcagcatttcaaagtgaaccaggacaagttcttgataacagcatttcaacagtactgtaaaaagat |
35354523 |
T |
 |
| Q |
187 |
gaaattgcaatatgccaccatcaactttctgcttgatgagaaatctattcaaggaaatcgtcaaacaccaaagatggttagtttcttcttgctttctcac |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354522 |
gaaattgcaatatgccaccatcaactttctgcttgatgagaaatctattcaaggaaatcgtcaaacaccaaagatggttagtttcttcttgctttctcac |
35354423 |
T |
 |
| Q |
287 |
attttccttcatttctagaataaaccgaatgttgtaaatagctaaacacattctg-----taaaagctctagaaatattaagta |
365 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35354422 |
attttccttcatttctagaaaaaaccgaatgttgtaaatagctaaacacattctgtaatataaaagctctagaaatattaagta |
35354339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University