View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8552_low_17 (Length: 297)
Name: NF8552_low_17
Description: NF8552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8552_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 79 - 268
Target Start/End: Complemental strand, 35354919 - 35354725
Alignment:
| Q |
79 |
gagttattttatgctgctttctttgcagtgnnnnnnn-----ttgtttttgctttcgatttgtgaaaaggatcttattaccgtctcttcttgtgtttgtg |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354919 |
gagttattttatgctgctttctttgcagtgaaaagaaaaaaattgtttttgctttcgatttgtgaaaaggatcttattaccgtctcttcttgtgtttgtg |
35354820 |
T |
 |
| Q |
174 |
tgtacacgtgtaggttaataagagcattatggcttcaaatggtatattgggtaataagagaaaggcttcagaaagagatgaagttactgaagatg |
268 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35354819 |
tgtacacatgtaggttgataagagcattatggcttcaaatggtatattgggtaataagagaaaggcttcagaaagagatgaagttactgaagatg |
35354725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University