View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8552_low_19 (Length: 282)
Name: NF8552_low_19
Description: NF8552
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8552_low_19 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 104 - 282
Target Start/End: Complemental strand, 13350671 - 13350494
Alignment:
| Q |
104 |
aaaagaatttttagttatccccgcctataaattttattcaattcattattttacaaatatcatgagcgatatagtctatgaaaatgtcacaatgaataat |
203 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13350671 |
aaaagaatgattagttatacccgcctataaattttattcaatt-attattttacaaatatcatgagcgatatagtctatgaaaatgtcacaatgaataat |
13350573 |
T |
 |
| Q |
204 |
aacaaccaatacaatacagctagtcgtgagaatcaaaacattgtcctccaaatataaatgaaccctcactaatcaccaa |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13350572 |
aacaaccaatacaatacagctagtcgtgagaatcaaaacattgtcctccaaatataaatgaaccctcactaatcaccaa |
13350494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University