View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8553_high_12 (Length: 234)
Name: NF8553_high_12
Description: NF8553
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8553_high_12 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 15 - 211
Target Start/End: Complemental strand, 454813 - 454617
Alignment:
| Q |
15 |
cagagagtgaagggacataacacagcaagcaatgtaatagcaaaatgcatcttattcaccgccggtgatcgtgaccgggaaacatctctccttctggcga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454813 |
cagagagtgaagggacataacacagcaagcaatgtaatagtaaaatgcatcttattcactgccggtgatcgtgaccgggaaacatctctccttctggcga |
454714 |
T |
 |
| Q |
115 |
cggtgtgaatgcgattatcctgaagttcatctagcaaatcatcgtcgcctttccttctctgcactgcgctttgctgctcttgttctgcacttgtact |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
454713 |
cggtgtgaatgcgattatcctgaagttcatctagcaaatcatcatcacctttccttctctgcactgcgctttgctgctcttgttctgcacttgtact |
454617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 62 - 103
Target Start/End: Complemental strand, 22773741 - 22773700
Alignment:
| Q |
62 |
catcttattcaccgccggtgatcgtgaccgggaaacatctct |
103 |
Q |
| |
|
|||||||||||||| ||| ||||||||||| ||||||||||| |
|
|
| T |
22773741 |
catcttattcaccggcggagatcgtgaccgagaaacatctct |
22773700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University