View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8554_high_5 (Length: 289)
Name: NF8554_high_5
Description: NF8554
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8554_high_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 275
Target Start/End: Original strand, 40043720 - 40043994
Alignment:
| Q |
1 |
tcagactcgagttgataaagagggctaggccaaggataggagggctttcagggactggggaagacgggtggattatagagcgatcagaggtttgtccatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40043720 |
tcagactcgagttgataaagagggctaggccaaggataggagggctttcagggactggggaagacgggtggattatagagcgatcagaggtttgtccatt |
40043819 |
T |
|
| Q |
101 |
gggattgggcatggacgagcctcgactgggccagcattgatgnnnnnnnncttatcccatcgcatcattaaccggtgtaggattaaagatcaggtccggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
40043820 |
gggattgggcatggacgagcctcgactgggccatcattgatgaaaaaaaacttatcccatcgcatcattaaccggtgtaggattaaagattaggtccggg |
40043919 |
T |
|
| Q |
201 |
attcgagtcaaatcgaccttccctctcatctcagggtgaggcaaggtagcttgctcgttcgttgttcaatatctc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40043920 |
attcgagtcaaatcgaccttccctctcatctcagggtgaggcaaggtagcttgctcgttcgttgttcaatatctc |
40043994 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 151 - 275
Target Start/End: Original strand, 23697295 - 23697419
Alignment:
| Q |
151 |
cttatcccatcgcatcattaaccggtgtaggattaaagatcaggtccgggattcgagtcaaatcgaccttccctctcatctcagggtgaggcaaggtagc |
250 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| || | |||||||||||| |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
23697295 |
cttatcccatcgcatcattaactggtgtaggattaaagatcaggtttggaactcgagtcaaatcaaccttccctctcatctcaaggtgaggtaaggtagc |
23697394 |
T |
|
| Q |
251 |
ttgctcgttcgttgttcaatatctc |
275 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
23697395 |
ttgctcgttcgttgttcaatatctc |
23697419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 118 - 193
Target Start/End: Complemental strand, 5038672 - 5038597
Alignment:
| Q |
118 |
agcctcgactgggccagcattgatgnnnnnnnncttatcccatcgcatcattaaccggtgtaggattaaagatcag |
193 |
Q |
| |
|
||||||||||| ||||||||||||| ||||| |||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5038672 |
agcctcgactgcgccagcattgatgaaaaaaaacttataccatcgcatcattaaccggtgtaggattaaaggtcag |
5038597 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University