View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8555_low_11 (Length: 288)
Name: NF8555_low_11
Description: NF8555
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8555_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 11 - 272
Target Start/End: Complemental strand, 40596739 - 40596479
Alignment:
| Q |
11 |
atactaaatgtccatgttattatagcaaacacctcctctatttaggcttagagctgtggatatatagtagtactagtagttgaaaatttcttgaaatgtg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40596739 |
atactaaatgtccatgttattatagcaaacacctcctctatttaggcttagagctgtggatatatagtagtactagtagttgaaaatttcttgaaatgtg |
40596640 |
T |
 |
| Q |
111 |
aaaaatacaaacaataattacctgtatctaatttgtggagcagagttgcattcttcactgtgaatttatttgtctattggctgttaaagtttcactatct |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40596639 |
aaaaatacaaacaataattacctgtatctaatttgtggagca-agttgcattcttcactgtgaatttatttgtctattggctgttacagtttcactatct |
40596541 |
T |
 |
| Q |
211 |
ttgttgcttatgtctacatattttgcataatatggaaccacagaatatctctcgacaatatc |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
40596540 |
ttgttgcttatgtctacatattttgcataatatggaaccacagaatatctctcaacaatatc |
40596479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University