View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8556_high_30 (Length: 240)

Name: NF8556_high_30
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8556_high_30
NF8556_high_30
[»] chr7 (2 HSPs)
chr7 (18-185)||(41795203-41795359)
chr7 (207-240)||(41795379-41795412)


Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 41795203 - 41795359
Alignment:
18 gaacttttgttagaaattagagacaaaaaactaatcttcaatttagatacttactgataattcaacttcttttaacaagcttaaaaataacatagagaga 117  Q
    |||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |||||||           ||||||||||||||||||||||    
41795203 gaacttttgttagaaattagagacaaaaaattaatcttgaatttagatacttactgatagttcaact-----------gcttaaaaataacatagagaga 41795291  T
118 tacatgaacaaatatgtgagattatgttgagattggtggtataaattaatgaaatatagttacataat 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41795292 tacatgaacaaatatgtgagattatgttgagattggtggtataaattaatgaaatatagttacataat 41795359  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 240
Target Start/End: Original strand, 41795379 - 41795412
Alignment:
207 tatctcattccaatttcattcaaattcatcctac 240  Q
    ||||||||||||||||||||||||||||||||||    
41795379 tatctcattccaatttcattcaaattcatcctac 41795412  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University