View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8556_low_12 (Length: 405)
Name: NF8556_low_12
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8556_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 18 - 56
Target Start/End: Original strand, 10819231 - 10819269
Alignment:
| Q |
18 |
agagggttcacgaagtttctcaagcaaatacttgagtcc |
56 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10819231 |
agagtgttcacgaagtttctcaagcaaatacttgagtcc |
10819269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 226 - 267
Target Start/End: Original strand, 73773 - 73814
Alignment:
| Q |
226 |
gaatttgattataccacataggaactagtaatgatggttatg |
267 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| || |||||| |
|
|
| T |
73773 |
gaatttgattataccatataggaactagtaataattgttatg |
73814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University