View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8556_low_24 (Length: 318)

Name: NF8556_low_24
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8556_low_24
NF8556_low_24
[»] chr5 (5 HSPs)
chr5 (195-297)||(35974811-35974913)
chr5 (95-187)||(35975041-35975133)
chr5 (95-164)||(35978003-35978072)
chr5 (28-64)||(35978103-35978139)
chr5 (199-270)||(35974946-35975017)


Alignment Details
Target: chr5 (Bit Score: 99; Significance: 7e-49; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 99; E-Value: 7e-49
Query Start/End: Original strand, 195 - 297
Target Start/End: Complemental strand, 35974913 - 35974811
Alignment:
Q  195 tggggcatgtagatgataatctaattgatgaatatggggcaatgcaaagtttggattttgtacaaattggttcccctaaagagagtaataatcctcatgt 294  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35974913 tggggcatatagatgataatctaattgatgaatatggggcaatgcaaagtttggattttgtacaaattggttcccctaaagagagtaataatcctcatgt 35974814  T
Q  295 ggg 297  Q
    |||    
T  35974813 ggg 35974811  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 95 - 187
Target Start/End: Complemental strand, 35975133 - 35975041
Alignment:
Q  95 tgatgttgtgcaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgacattacagatgaatacttgaagag 187  Q
    |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35975133 tgatgttgtgtaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgacattacagatgaatacttgaagag 35975041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 95 - 164
Target Start/End: Complemental strand, 35978072 - 35978003
Alignment:
Q  95 tgatgttgtgcaggttgtagagggtgtgtgtaatgaccagatggatttttcgtggatggataactttgac 164  Q
    ||||| ||||| ||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  35978072 tgatgctgtgctggttggagagggtgtgtgtaatgaccagatggatttttcatggatggataactttgac 35978003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 28 - 64
Target Start/End: Complemental strand, 35978139 - 35978103
Alignment:
Q  28 ttggtggtggtgaaagccaagatgcaaattcagaagg 64  Q
    ||||||||||||||| |||||||||||||||||||||    
T  35978139 ttggtggtggtgaaatccaagatgcaaattcagaagg 35978103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 199 - 270
Target Start/End: Complemental strand, 35975017 - 35974946
Alignment:
Q  199 gcatgtagatgataatctaattgatgaatatggggcaatgcaaagtttggattttgtacaaattggttcccc 270  Q
    |||| |||||||||| | ||||||||||||||||     ||||||||||||||| | |||||||||||||||    
T  35975017 gcatatagatgataaaccaattgatgaatatgggctgcggcaaagtttggatttgggacaaattggttcccc 35974946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University