View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8556_low_39 (Length: 250)
Name: NF8556_low_39
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8556_low_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 46 - 246
Target Start/End: Complemental strand, 39023436 - 39023237
Alignment:
| Q |
46 |
gtgtgactaaataaaatgtctaaattctcgtgtctatcaaaagaattatccatgactttgttgtgatagtattccttttttaaactgggtttgatagtat |
145 |
Q |
| |
|
||||||||| |||||||||||||||||| |||||||||||| |||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39023436 |
gtgtgactagataaaatgtctaaattcttgtgtctatcaaa-gaattatctatgactttgttgtgatagtattgcttttttaaactgggtttgatagtat |
39023338 |
T |
 |
| Q |
146 |
atgtatatctctaaagtatcgttaatttctctagcgaactaattattgttactctatttggtcccaatggttggtaccaactacacaatctctgcttctc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||| ||||| |
|
|
| T |
39023337 |
atgtatatctctaaagtatcgttaatttctctagcgaactaattattgttactctatttggttccaatggttggtactaactacacaatcactgtttctc |
39023238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University