View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8556_low_42 (Length: 242)
Name: NF8556_low_42
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8556_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 1055284 - 1055054
Alignment:
| Q |
1 |
aggaagagatggatggagttggagccatgcaccccatttgcgtgaacggagaagaggacacgatagtacttttacttctctaacctctcttcttttcttt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1055284 |
aggaggagatggatggagttggagccatgcaccccatttgcgtgaacggagaagaggacacgatagtacttttacttctctaacctctcttcttttcttt |
1055185 |
T |
|
| Q |
101 |
tgtgattggtttctttat-------tattagttattagttttcgttatttcgatttccacgatgacgactttccctcgttttagacggaggtcgctattt |
193 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1055184 |
tgtgattggtttctttattatttattattagttattagttttcgttatttcgatttccacgatgacgactttccctcgttttagacggaggtcgctattt |
1055085 |
T |
|
| Q |
194 |
gaacccnnnnnnnaggtaatacacccacatt |
224 |
Q |
| |
|
|||||| |||||||||||||||||| |
|
|
| T |
1055084 |
gaaccctttttttaggtaatacacccacatt |
1055054 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University