View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8556_low_44 (Length: 240)
Name: NF8556_low_44
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8556_low_44 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 18 - 185
Target Start/End: Original strand, 41795203 - 41795359
Alignment:
| Q |
18 |
gaacttttgttagaaattagagacaaaaaactaatcttcaatttagatacttactgataattcaacttcttttaacaagcttaaaaataacatagagaga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
41795203 |
gaacttttgttagaaattagagacaaaaaattaatcttgaatttagatacttactgatagttcaact-----------gcttaaaaataacatagagaga |
41795291 |
T |
 |
| Q |
118 |
tacatgaacaaatatgtgagattatgttgagattggtggtataaattaatgaaatatagttacataat |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41795292 |
tacatgaacaaatatgtgagattatgttgagattggtggtataaattaatgaaatatagttacataat |
41795359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 207 - 240
Target Start/End: Original strand, 41795379 - 41795412
Alignment:
| Q |
207 |
tatctcattccaatttcattcaaattcatcctac |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41795379 |
tatctcattccaatttcattcaaattcatcctac |
41795412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University