View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8556_low_49 (Length: 234)
Name: NF8556_low_49
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8556_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 22 - 221
Target Start/End: Complemental strand, 28240940 - 28240741
Alignment:
| Q |
22 |
caggaagaagtcaaacggatccaatctgttccgcttgtgatcggtcagtttatggagatggttgataccaataacgggattgttggatctacgactgggt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28240940 |
caggaagaagtcaaacggatccaatctgttccgcttgtgatcggtcagtttatggagatggttgataccaataacgggattgttggatctacgactgggt |
28240841 |
T |
 |
| Q |
122 |
cgaattactatgttaggattttgagtacgattaatcgggagcttttgaagccgtcggcttcggttgcacttcatcgtcattcgaatgcgcttgttgatgt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28240840 |
cgaattactatgttaggattttgagtacgattaatcgggagcttttgaaaccttcggcttcggttgcacttcatcgtcattcgaatgcgcttgttgatgt |
28240741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University