View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8556_low_52 (Length: 218)
Name: NF8556_low_52
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8556_low_52 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 208
Target Start/End: Complemental strand, 45616096 - 45615885
Alignment:
| Q |
1 |
agtctatgatttta-tattttatttttgactgatgtcttaaccacccattttct-taatgatttcttttccaaaattctatttctaaaagggcaagctgg |
98 |
Q |
| |
|
|||||||||||| | ||| |||||||||||||||| |||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45616096 |
agtctatgatttaagtatcttatttttgactgatgacttaaccaaccattttctctaatgatttcttttcaaaaattctatttctaaaagggcaagctgg |
45615997 |
T |
 |
| Q |
99 |
tatcctactttgaacctagctatattcttagatggaccctacttatggtttataatc--ttctattagttcaaattccagagcggcataaataaagagta |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45615996 |
tatcctactttgaacctagctatattcttagatggaccctacttatggcttataatctgtgctattagtccaaattccagagcggcataaataaagagta |
45615897 |
T |
 |
| Q |
197 |
gccacaggttct |
208 |
Q |
| |
|
|||||||||||| |
|
|
| T |
45615896 |
gccacaggttct |
45615885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University