View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8556_low_8 (Length: 434)
Name: NF8556_low_8
Description: NF8556
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8556_low_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 20 - 422
Target Start/End: Original strand, 43852454 - 43852828
Alignment:
| Q |
20 |
aagaggagattgttaagtgctatgggtggaagtgtaaacatccaccaatttgtttctaatgaggatgaaggtaaacccattatgtaaaggcagggaatga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
43852454 |
aagaggagattgttaagtgctatgggtggaagtgtaaacatccaccaatttgtttctaatgaggatgacggtaaacccattatgtaaaggcaaggaatga |
43852553 |
T |
 |
| Q |
120 |
aaacaaaggttgtggaagaatgcaaaagaaagatggtcatgggacttgggaggattgatgttgaaggagaggtgagaaagcttggtataaatagctgtgc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
43852554 |
aaacaaaggttgtggaagaatgcaaaagaaagatgg------gacttgggagga--------------gaggttagaaagcttggtataaatagctgtgc |
43852633 |
T |
 |
| Q |
220 |
atgcatgggatgagatagaggtttttggggtaggctggtagggtaaatttgaagatatttgtatagagtgagtcaccacaatggtattattaattaaaat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43852634 |
atgcatgggatgagatagaggtttttggggta--------gggtaaatttgaagatatttgtatagagtgagtcaccacaatggtattattaattaaaat |
43852725 |
T |
 |
| Q |
320 |
tgtagtcgttggtcaatttaatttataaatttatagataatattttagtccttgaaattgaagaccatgcaaaccaatttagtctctgctactccacttt |
419 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||| || ||||| |
|
|
| T |
43852726 |
tgtagtcgttggtcaatttaatttataaatttatagataatattttactccttgaaattgaagaccatgcaaaccaatttagtctttgctaatcaacttt |
43852825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University