View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_high_5 (Length: 369)
Name: NF8557_high_5
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_high_5 |
 | |
|
| [»] scaffold0449 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0449 (Bit Score: 300; Significance: 1e-168; HSPs: 1)
Name: scaffold0449
Description:
Target: scaffold0449; HSP #1
Raw Score: 300; E-Value: 1e-168
Query Start/End: Original strand, 34 - 361
Target Start/End: Complemental strand, 4194 - 3867
Alignment:
| Q |
34 |
ctatcacaatccaaaaggtatgcattcttggcctttctgaggacttgaaagatgacattgagaaaatttcagtatacattcttggcctttgcatgagttt |
133 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4194 |
ctatcacaacccaaaaggtatgcattcttggcctttctcaggacttgaaagatcacattgagaaaatttcagtatgcattcttggcctttgcatgagttt |
4095 |
T |
|
| Q |
134 |
cttctcatatgaccctcccacatcagagatagtgaaagagtttacgatatttgctgcgtcgtcatttgtatgttacattctctcaatcatcctcaagaaa |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4094 |
cttctcatatgaccctcccacatcagagatagtgaaagagtttacgatatttgctgcgtcgtcatttgtatgttacattctctcaatcatcctcaagaaa |
3995 |
T |
|
| Q |
234 |
accctaatgctctgcccaacctgaaccagctgccgcgcgataactttgatatgtgattttctatttttctttggatggtgcttttacgcgctgctcatgc |
333 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3994 |
accctaatgctctgcccaacctggaccagccgccgcgccataactttgatatgtgattttctatttttctttggatggtgcttttacgcgctgctcatgc |
3895 |
T |
|
| Q |
334 |
tccaatatgtcattcctctcaaagatct |
361 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
3894 |
tccaatatgtcattcctctcaaagatct |
3867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University