View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_15 (Length: 335)
Name: NF8557_low_15
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 281; Significance: 1e-157; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 281; E-Value: 1e-157
Query Start/End: Original strand, 18 - 322
Target Start/End: Complemental strand, 48802380 - 48802076
Alignment:
| Q |
18 |
gttttgacttttgagagtttcatattgactagagatatgacttagatagtgcttgtaaggtttgagcagtccggatcctacaagtcattttgtaggattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48802380 |
gttttgacttttgagagtttcatattgactagagatatgacttagatagtgcttgttaggtttgagcagtccggatccaacaagtcattttgtaggattt |
48802281 |
T |
|
| Q |
118 |
tgtcacaatcaatgtcagaattctaagatttgaagttctgatgaccttagaggttgcatgcaatagtgagctatgtaccactaatacgatgtgtcgagtg |
217 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
48802280 |
tgtcacactcaatgtcagaattctaagatttgaagttctgatgaccttagaggttgcatgcaatagtgagctatgaaccactaatacgatgtgtcgagtg |
48802181 |
T |
|
| Q |
218 |
tccaatacttgtcggtctttgacactaacacgacatgcatgtggatacactcaatcacttcaattttctcaaattatcaacttcagtgtcatgtttgttg |
317 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48802180 |
tccaatacgtgtcggtctttgacactgacacgacatgcatgtggatacactcaatcacttcaattttctcaaattatcaacttcagtgtcatgtttgttg |
48802081 |
T |
|
| Q |
318 |
catct |
322 |
Q |
| |
|
||||| |
|
|
| T |
48802080 |
catct |
48802076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University