View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_17 (Length: 331)
Name: NF8557_low_17
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_17 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 3e-85; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 54 - 229
Target Start/End: Complemental strand, 24552707 - 24552532
Alignment:
| Q |
54 |
gaagataagcagtacttgtagttgcagaaatggtgaatgtagcagggcggcctcttgcaatgggatcaggagatatttgaacttctttaacctcaatatc |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24552707 |
gaagataagcagtacttgtagttgcagaaatggtgaatgtagcagggcggcctcttgcaatgggatcaggagatatttgaacttctttaacctcaatatc |
24552608 |
T |
 |
| Q |
154 |
atagctagctttcttatctgtggcaaacatacaagataatcaggtaatatagtttattcaataaaagcaacactaa |
229 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
24552607 |
atagctagctttcttatctgtggcatacatagaagataattaagtaatatagtttattcaataaaagcaacactaa |
24552532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 54 - 175
Target Start/End: Complemental strand, 24562726 - 24562605
Alignment:
| Q |
54 |
gaagataagcagtacttgtagttgcagaaatggtgaatgtagcagggcggcctcttgcaatgggatcaggagatatttgaacttctttaacctcaatatc |
153 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||| ||| |||||||||||||||||| ||||||| | || ||| |
|
|
| T |
24562726 |
gaagataagcattacttgtatttgcagaaatggtgaatgtagcaggttggcctcttgcaacggggtcaggagatatttgaactcctttaacttgaacatc |
24562627 |
T |
 |
| Q |
154 |
atagctagctttcttatctgtg |
175 |
Q |
| |
|
||||||| |||||||| ||||| |
|
|
| T |
24562626 |
atagctatctttcttacctgtg |
24562605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 303
Target Start/End: Original strand, 473036 - 473071
Alignment:
| Q |
268 |
ctgtttggataaacaacttatatgcagcttacaaca |
303 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
473036 |
ctgtttggataaacaacttatttgcagcttacaaca |
473071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 269 - 307
Target Start/End: Original strand, 46423151 - 46423189
Alignment:
| Q |
269 |
tgtttggataaacaacttatatgcagcttacaacacaag |
307 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
46423151 |
tgtttggataaacaacttatttgcagcttataacacaag |
46423189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 268 - 314
Target Start/End: Complemental strand, 47499033 - 47498987
Alignment:
| Q |
268 |
ctgtttggataaacaacttatatgcagcttacaacacaagtgattat |
314 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||| |||| |
|
|
| T |
47499033 |
ctgtttggataaacaacttatttgcagcttatagcacaagtgcttat |
47498987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 266 - 306
Target Start/End: Original strand, 34236040 - 34236080
Alignment:
| Q |
266 |
tcctgtttggataaacaacttatatgcagcttacaacacaa |
306 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
34236040 |
tcctgtttggataaacaacttatttgcagcttataacacaa |
34236080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 267 - 300
Target Start/End: Original strand, 18133555 - 18133588
Alignment:
| Q |
267 |
cctgtttggataaacaacttatatgcagcttaca |
300 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
18133555 |
cctgtttggataaacaacttatttgcagcttaca |
18133588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000007; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 268 - 307
Target Start/End: Complemental strand, 12433570 - 12433531
Alignment:
| Q |
268 |
ctgtttggataaacaacttatatgcagcttacaacacaag |
307 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
12433570 |
ctgtttggataaacaacttatttgcagcttataacacaag |
12433531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 263 - 303
Target Start/End: Complemental strand, 13697964 - 13697924
Alignment:
| Q |
263 |
tattcctgtttggataaacaacttatatgcagcttacaaca |
303 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
13697964 |
tattactgtttggataaacaacttatttgcagcttataaca |
13697924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000007; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 267 - 314
Target Start/End: Original strand, 4606860 - 4606907
Alignment:
| Q |
267 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattat |
314 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||||| |||| |
|
|
| T |
4606860 |
cctgtttggataaacaacttattcgcagcttataacacaagtgcttat |
4606907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 267 - 314
Target Start/End: Complemental strand, 41812275 - 41812228
Alignment:
| Q |
267 |
cctgtttggataaacaacttatatgcagcttacaacacaagtgattat |
314 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| | ||||||||||||| |
|
|
| T |
41812275 |
cctgtttggataaacaacttatttgcagtttatagcacaagtgattat |
41812228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 266 - 303
Target Start/End: Complemental strand, 7043914 - 7043877
Alignment:
| Q |
266 |
tcctgtttggataaacaacttatatgcagcttacaaca |
303 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
7043914 |
tcctgtttggataaacaacttatttgcagcttataaca |
7043877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 267 - 307
Target Start/End: Complemental strand, 26143831 - 26143791
Alignment:
| Q |
267 |
cctgtttggataaacaacttatatgcagcttacaacacaag |
307 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| |||||||| |
|
|
| T |
26143831 |
cctgtttggataaacaacttatttgcagtttataacacaag |
26143791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 266 - 298
Target Start/End: Complemental strand, 39659710 - 39659678
Alignment:
| Q |
266 |
tcctgtttggataaacaacttatatgcagctta |
298 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
39659710 |
tcctgtttggataaacaacttatttgcagctta |
39659678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 269 - 309
Target Start/End: Original strand, 58475 - 58515
Alignment:
| Q |
269 |
tgtttggataaacaacttatatgcagcttacaacacaagtg |
309 |
Q |
| |
|
|||||||||||||||||||| ||||||||| | |||||||| |
|
|
| T |
58475 |
tgtttggataaacaacttatttgcagcttagagcacaagtg |
58515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 271 - 307
Target Start/End: Original strand, 28900760 - 28900796
Alignment:
| Q |
271 |
tttggataaacaacttatatgcagcttacaacacaag |
307 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
28900760 |
tttggataaacaacttatttgcagcttataacacaag |
28900796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 267 - 307
Target Start/End: Original strand, 46139821 - 46139861
Alignment:
| Q |
267 |
cctgtttggataaacaacttatatgcagcttacaacacaag |
307 |
Q |
| |
|
||||||||| |||||||||||| ||||||||| |||||||| |
|
|
| T |
46139821 |
cctgtttggttaaacaacttatttgcagcttataacacaag |
46139861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 266 - 314
Target Start/End: Original strand, 4212810 - 4212858
Alignment:
| Q |
266 |
tcctgtttggataaacaacttatatgcagcttacaacacaagtgattat |
314 |
Q |
| |
|
||||||||||||||||||||||| | ||||||| | |||||| |||||| |
|
|
| T |
4212810 |
tcctgtttggataaacaacttattttcagcttatagcacaagcgattat |
4212858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 266 - 306
Target Start/End: Complemental strand, 34213770 - 34213730
Alignment:
| Q |
266 |
tcctgtttggataaacaacttatatgcagcttacaacacaa |
306 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||| ||||||| |
|
|
| T |
34213770 |
tcctgtttggataagcaacttatttgcagcttataacacaa |
34213730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 268 - 304
Target Start/End: Original strand, 944363 - 944399
Alignment:
| Q |
268 |
ctgtttggataaacaacttatatgcagcttacaacac |
304 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
944363 |
ctgtttggataaacaacttatttgcagcttataacac |
944399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 267 - 307
Target Start/End: Complemental strand, 26990681 - 26990641
Alignment:
| Q |
267 |
cctgtttggataaacaacttatatgcagcttacaacacaag |
307 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
26990681 |
cctgtttggatcaacaacttatatgcaacttataacacaag |
26990641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 271 - 307
Target Start/End: Complemental strand, 34610993 - 34610957
Alignment:
| Q |
271 |
tttggataaacaacttatatgcagcttacaacacaag |
307 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
34610993 |
tttggataaacaacttatctgcagcttataacacaag |
34610957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 266 - 298
Target Start/End: Complemental strand, 46886889 - 46886857
Alignment:
| Q |
266 |
tcctgtttggataaacaacttatatgcagctta |
298 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
46886889 |
tcctgtttggataaacaacttatttgcagctta |
46886857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University