View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_24 (Length: 253)
Name: NF8557_low_24
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 14 - 219
Target Start/End: Original strand, 51118333 - 51118539
Alignment:
| Q |
14 |
cagagatatagtcatggtcatattaatgtttgcaacatcttgaatgtcttgctttgcacttcaggtagctattgaagccataccgatcagcggctgcaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |||||| || |
|
|
| T |
51118333 |
cagagatatagtcatggtcatattaatgtttgcaacatcttgaatgccttgctttgcacttcaggtagctattgaagccatacggatcagtggctgctaa |
51118432 |
T |
|
| Q |
114 |
cagataaggattgagtactcgacaaatattttcaagtttataactatttatttgagcgatatttagttgtttggga-ttgtatcatctgttgaagtgcaa |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51118433 |
cagataaggattgagtactcgacaaatattttcaagtttataactatttatttgagcgatatttagttgtttgggatttgtatcatctgttgaagtgcaa |
51118532 |
T |
|
| Q |
213 |
atttttg |
219 |
Q |
| |
|
||||||| |
|
|
| T |
51118533 |
atttttg |
51118539 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 175 - 253
Target Start/End: Original strand, 51111554 - 51111632
Alignment:
| Q |
175 |
tttagttgtttgggattgtatcatctgttgaagtgcaaatttttggtttgttcctctctcaatcggagttttcaaattt |
253 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||||||||| |||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
51111554 |
tttagttgtttaggattctatcatatgttgaagtgcaacattttggttcggtcctctctcaatccgagttttcaaattt |
51111632 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University