View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_26 (Length: 250)
Name: NF8557_low_26
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 38446130 - 38446002
Alignment:
| Q |
1 |
aatgaattgataccgttgatattgaagaagggagtcttttaacggagtagatgcgttttcctgggtggcgatcgaagatgtgaaagaaacctgacatgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38446130 |
aatgaattgataccgttgatattgaagaagggagtcttttaacggagtagatgcgttttcctgggtggcgatcgaagatgtgaaagaaacctgacatgca |
38446031 |
T |
|
| Q |
101 |
ccctatttgtttttggatttgtttctcaa |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38446030 |
ccctatttgtttttggatttgtttctcaa |
38446002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 196 - 240
Target Start/End: Complemental strand, 38445935 - 38445891
Alignment:
| Q |
196 |
caatattgtgaagagtttctcacattctgttctgctgcttctctg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38445935 |
caatattgtgaagagtttctcacattctgttctgctgcttctctg |
38445891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University