View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_31 (Length: 242)
Name: NF8557_low_31
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 3e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 19 - 163
Target Start/End: Complemental strand, 19602733 - 19602589
Alignment:
| Q |
19 |
atataacagaggaatttatagatataataagaatcaatgaatcatgatatggtccatatgaatcgggtttaaaaatagtgtgaatttaatactttattct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
19602733 |
atataacagaggaatttatagatataataagaatcaatgaatcataatatggtccatatgagtcgggtttaaaaatagtgtgaatttaatacttttttct |
19602634 |
T |
 |
| Q |
119 |
ttgaaataaatatagtttccgttgtttatgtattttttgccagcc |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19602633 |
ttgaaataaatatagtttccgttgtttatgtattttttgccagcc |
19602589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 179 - 242
Target Start/End: Complemental strand, 19602535 - 19602472
Alignment:
| Q |
179 |
aacatgtaacggcataaatttatcatgtttgtcggtttaattctttttggatagaacgcccgtt |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19602535 |
aacatgtaacggcataaatttatcatgtttgtcggtttaattctttttggatagaacgcccgtt |
19602472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University