View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_33 (Length: 242)
Name: NF8557_low_33
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_33 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 11 - 229
Target Start/End: Complemental strand, 2237433 - 2237215
Alignment:
| Q |
11 |
cagagaatcactcaaattcaatcttggcccttgatttggacagtggtgattttaaatggtaccaacaattaggaggtctagatgtatggtttgttgcatg |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| || | ||||||||| ||||||||||||| ||||||||||||||| |||| |
|
|
| T |
2237433 |
cagaaaatcactcaaattcaatcttggcccttgatttggacagtggtaatatcaaatggtacaaacaattaggaggatatgatgtatggtttgtttcatg |
2237334 |
T |
 |
| Q |
111 |
taaaaatgcttcacttcctaattgtccgcctcaaggtcctataccagatgcagattttggagaggcaccaatgatgttaactacacatgtaaatggtact |
210 |
Q |
| |
|
||| ||||||||| || |||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
2237333 |
taacaatgcttcaatttctaattgtccacctcaaggttctataccagatgcagattttggagaggcaccaatgatgttaactacacatgtaaatggaaca |
2237234 |
T |
 |
| Q |
211 |
gagaaagacattgttgttg |
229 |
Q |
| |
|
||||||| |||||||||| |
|
|
| T |
2237233 |
aagaaagatattgttgttg |
2237215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 11 - 83
Target Start/End: Original strand, 2261078 - 2261150
Alignment:
| Q |
11 |
cagagaatcactcaaattcaatcttggcccttgatttggacagtggtgattttaaatggtaccaacaattagg |
83 |
Q |
| |
|
|||| ||||| || ||||||||||| || ||||||||| ||| |||||| ||||||||||||| |||||||| |
|
|
| T |
2261078 |
cagaaaatcattctaattcaatcttagcacttgatttgtacaatggtgaaattaaatggtaccatcaattagg |
2261150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University