View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_34 (Length: 241)
Name: NF8557_low_34
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_34 |
 |  |
|
| [»] scaffold0045 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0045 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 19 - 175
Target Start/End: Original strand, 75083 - 75233
Alignment:
| Q |
19 |
aaatgtcacttgtatgtacaatggaagagtattaatggattacattttagtttgatgtttaatatccacctttatcatgtttatgtgagacatgaataat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75083 |
aaatgtcacttgtatgtacaatggaagagtattaatggattacattttagtttgatgtttaatatccacctttatcatgtttatgtgagacatgaataat |
75182 |
T |
 |
| Q |
119 |
tagagtgagtgatgtctacaattagagtgggtctgggtgatgaaataaattaatttt |
175 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
75183 |
tagagtgagtgatgtctacaattagag------tgggtgatgaaataaattaatttt |
75233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 177 - 224
Target Start/End: Original strand, 75545 - 75592
Alignment:
| Q |
177 |
gaaaaaattatatgaataggcgtgtttttggtattatggtaatttttt |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
75545 |
gaaaaaattatatgaataggcgtgtttttggtattatggtaatttttt |
75592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University