View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_39 (Length: 230)
Name: NF8557_low_39
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_39 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 33980889 - 33981118
Alignment:
| Q |
1 |
gcataaactatagaccatggtttggcagcaagaaagtcagtatcaaaaagtatactatatctgtacaatacttgtgcaaatggattcccttgtgagagaa |
100 |
Q |
| |
|
|||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
33980889 |
gcataagctataaagcatggtttggcagcaagaaagtcagtatcaaaaagtatactatatctgaacaatacttgtgcaaatggattcccttgtgagagaa |
33980988 |
T |
|
| Q |
101 |
agagacttccaatcctagaaaatcattgaggggtcatatttctttgattatgaagatgtcctcaaggtattggtttcctgaattaatctcataaaggttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||| |||||||| |
|
|
| T |
33980989 |
agagacttccaatcctagaaaatcattgaggggtcatatttctttgattatgaagatgtcctcaaggcattggtttactgaattaatctcagaaaggttt |
33981088 |
T |
|
| Q |
201 |
tttctagctaagattactttatttttattt |
230 |
Q |
| |
|
|||||||||||| ||||||||||||||||| |
|
|
| T |
33981089 |
tttctagctaaggttactttatttttattt |
33981118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University