View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_40 (Length: 226)
Name: NF8557_low_40
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 55; Significance: 9e-23; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 26713628 - 26713690
Alignment:
| Q |
1 |
cccacacgggtttataggtattgctctttcttaaaattttcacacttattattgcggtagtta |
63 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26713628 |
cccacacgggtttataggtcttgctctgtcttaaaattttcacacttattattgcggtagtta |
26713690 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 63
Target Start/End: Original strand, 26983367 - 26983429
Alignment:
| Q |
1 |
cccacacgggtttataggtattgctctttcttaaaattttcacacttattattgcggtagtta |
63 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26983367 |
cccacacgggtttataggtcttgctctgtcttaaaattttcacacttattattgcggtagtta |
26983429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University