View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_42 (Length: 218)
Name: NF8557_low_42
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_42 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 27 - 201
Target Start/End: Original strand, 371487 - 371661
Alignment:
| Q |
27 |
ctttcaaggtcttttcaataagcttacgagcttttctgcttcgaatctcaaccttaacacttgcactcttgtccatctttatgtatggcttctttccttt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
371487 |
ctttcaaggtcttttcaataagcttacgagcttttctgcttcgaatctcaaccttaacacttgcactcttgtccatctttatgtatggcttctttccttt |
371586 |
T |
 |
| Q |
127 |
cttcatcttcaacgttgacttcacctttgactttattgattccaccagatttccaagctgattcgccattcttct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
371587 |
cttcatcttcaacgttgacttcacctttgactttattgattccaccagatttccaagttgattcgccattcttct |
371661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University