View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8557_low_9 (Length: 388)
Name: NF8557_low_9
Description: NF8557
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8557_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-121; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 141 - 380
Target Start/End: Complemental strand, 50651615 - 50651375
Alignment:
| Q |
141 |
gtgatcccaagggtagcagctcaagcaaagcagtttgattcaatggtgtcgtactaccagcatttttct-ctctcatcataatgagttggtattggaata |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
50651615 |
gtgatcccaagggtagcagctcaagcaaagcagtttgattcaatggtgtcgtcctaccagcattttttttctctcatcataatgagttggtattggaata |
50651516 |
T |
 |
| Q |
240 |
tgtattagggacgagatgatttgtttgtcggagtgaacactctatggttggaacctttgatgtcagtccgaatgggagaagcaaaagctttgttagatgc |
339 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651515 |
tgtattagggacgagatgatttgtttgtcggagtgaacactctatggctggaacctttgatgtcagtccgaatgggagaagcaaaagctttgttagatgc |
50651416 |
T |
 |
| Q |
340 |
atttttgtggagtattgagctgggatttgacagaattatct |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651415 |
atttttgtggagtattgagctgggatttgacagaattatct |
50651375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 20 - 101
Target Start/End: Complemental strand, 50651696 - 50651615
Alignment:
| Q |
20 |
gagcttgtggaagagtaggaacctgacaatttgggaaaataaagtcgaaagttcagctgatgtggtttgtagaggtcgagcg |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50651696 |
gagcttgtggaagagtaggaacctgacaatttgggaaaataaagtcgaaagttcagctgatgtggtttgtagaggtcgagcg |
50651615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University