View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8558_low_11 (Length: 260)
Name: NF8558_low_11
Description: NF8558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8558_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 18 - 189
Target Start/End: Complemental strand, 38866174 - 38866002
Alignment:
| Q |
18 |
gtgaatgggtgtaatttttaaaaaagctaaaactgtcatttttgttggtttgtagggtgtgagtataattgttggggtataaggtataatttcc-taatt |
116 |
Q |
| |
|
||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| | ||| |
|
|
| T |
38866174 |
gtgaatgggtgtaattttttaaaaagctaaaattgtcatttttgttggtttgtagggtgtgagtataattgttggggtatagggtataatttccatgatt |
38866075 |
T |
 |
| Q |
117 |
tgatatctatttcaactttcaatattaatttatgataattgtgctttaaatttgtacatttattagcgcgttt |
189 |
Q |
| |
|
|||||| | ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38866074 |
tgatatatgtttcaactttcaatattaatttacgataattgtgctttaaatttgtacatttatttacgcgttt |
38866002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University