View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8558_low_12 (Length: 255)
Name: NF8558_low_12
Description: NF8558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8558_low_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 1 - 161
Target Start/End: Complemental strand, 39126245 - 39126085
Alignment:
| Q |
1 |
aaaattcataattactgtgaataaaattatctttttccaaataattattgtgaaggtttttaagacttttagatattctaaaaatattgatgatgggtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39126245 |
aaaattcataattactgtgaataaaattatctttttccaaataattattgtgaaggtttttaagacttttagatattctaaaaatattgatgatgggtac |
39126146 |
T |
 |
| Q |
101 |
gtagatcaaaaatcacatcctaattgacatcaaatatcctccggctcttccactttttaaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39126145 |
gtagatcaaaaatcacatcctaattgacatcaaatatcctccggctcttccactttttaaa |
39126085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University