View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8558_low_16 (Length: 244)
Name: NF8558_low_16
Description: NF8558
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8558_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 67; Significance: 7e-30; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 22 - 92
Target Start/End: Complemental strand, 54262698 - 54262628
Alignment:
| Q |
22 |
ctacacacgatcaaaagtatttagattctaaatggtccctcacctaaaacttgacaggatgctattcattt |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
54262698 |
ctacacacgatcaaaagtatttagattctaaatggtccctcacctaaaagttgacaggatgctattcattt |
54262628 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 206 - 244
Target Start/End: Complemental strand, 54262627 - 54262589
Alignment:
| Q |
206 |
attgagagatacaatttatagttcttcgcttatgtatat |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
54262627 |
attgagagatacaatttatagttcttcgcttttgtatat |
54262589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University