View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8559_high_2 (Length: 338)
Name: NF8559_high_2
Description: NF8559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8559_high_2 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 149; Significance: 1e-78; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 18 - 192
Target Start/End: Original strand, 491692 - 491863
Alignment:
| Q |
18 |
gataccgatagatttaatgttgaaagaagctctccaagattgagtgacgtgattttaagtggaaaacaactagagatttctccaagaagctcgtctaggt |
117 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
491692 |
gataccgatagatttaatgttgcaagaagctctccaagattgagtgacgtgattttaagtggaaaac---tagagatttctccaagaagctcgtctaggt |
491788 |
T |
 |
| Q |
118 |
caccgcaaaagtaagagaggtcgagggaggaattccagataatgagtgagaaacgggaaaggttgatgatgtata |
192 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
491789 |
caccgcgaaagtaagagaggtcgagggaggaattccagataatgagtgagaaacgggaacggttgatgatgtata |
491863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 278 - 322
Target Start/End: Original strand, 491943 - 491987
Alignment:
| Q |
278 |
aacattcattccttcattgcattataagaatctttgacatgctct |
322 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
491943 |
aacatacattccttcattgcattataagaatctttgacatgctct |
491987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University