View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8559_high_6 (Length: 277)
Name: NF8559_high_6
Description: NF8559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8559_high_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 6 - 263
Target Start/End: Complemental strand, 11024286 - 11024029
Alignment:
| Q |
6 |
caatgagatggacatcagtcaccaatttctcgttgtaatattgatccccgaatccgggcattgtaaccattggtactccggaacttattgcttccacggt |
105 |
Q |
| |
|
||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024286 |
caatgcgatgcacctcagtcaccaatttctcgttgtaatattgatccccgaatccgggcattgtaaccattggtactccggaacttattgcttccacggt |
11024187 |
T |
 |
| Q |
106 |
cgcgttccagccacaatgcgttaagaatccgcctatcgatggatgatccaatattaacgcttgtggaacccatcctttaatcaacattcctttcttttct |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11024186 |
cgcgttccagccacaatgcgttaagaatccgcctatcgatggatgatccaatattaacgcttgtggaacccatcctttaatcaacattcctttcttttct |
11024087 |
T |
 |
| Q |
206 |
tccttcatcctctcggtaaaaccttttggtaaccaattatcttcatcttcaccttctt |
263 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11024086 |
tccttcatcctctctacaaaaccttttggtaaccaattatcttcatcttctccttctt |
11024029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University