View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8559_low_5 (Length: 295)
Name: NF8559_low_5
Description: NF8559
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8559_low_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 278
Target Start/End: Complemental strand, 35424019 - 35423755
Alignment:
| Q |
11 |
cagagatatataccgtcttcaacattttgtattccaaaatacttgtttggaggtttgctacataaatggaactttttaataattgtcagatatttgtcaa |
110 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
35424019 |
cagagatatatactgtcttcaacattttgtattccaaaatacttgtttggaggtttgctacataaatggagcattttaataattgtcagatatttgtcaa |
35423920 |
T |
 |
| Q |
111 |
aataattataataattgcgagttcagactagacaagacaagtgtgggtggatcatgaagtattgaaaattttcactaacgacttatttaaaattttgttg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| | |
|
|
| T |
35423919 |
aataattataataattgcgagttcagactaga-----caagtgtgggtggatcatgaggtattgaaaaatttcactaacgacttatttaaaattttgtcg |
35423825 |
T |
 |
| Q |
211 |
ggagccggtcctag--nnnnnnnnagccgagagaaatttcattctctctctaatttcttatcttcttcat |
278 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35423824 |
ggagccggtcctagttttttttttagccgagagaaatttcattctctctctaatttcttatcttcttcat |
35423755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University