View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8560_high_36 (Length: 239)
Name: NF8560_high_36
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8560_high_36 |
 | |
|
| [»] scaffold1430 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 229
Target Start/End: Original strand, 6299048 - 6299276
Alignment:
| Q |
1 |
ttctacgattttaattcttttcaccaacctttgttttttagaaaatttatgatcttggtggtcgaaaatttgtgatcggtagcattggtccaattgggtg |
100 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6299048 |
ttctatgattttaattcttttcaccaacctttgatttttagaaaatttatgatcttggtggtcgaaaatttgtgatcggtagcattggtccaattgggtg |
6299147 |
T |
|
| Q |
101 |
tgccccatcatttattattagaacatcaagttcaaaagattgcaatgaagatatgaatcaaaaggttaagcccttctcaaacaaactcccatggaagctt |
200 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6299148 |
tgccccatcatttattaatagaacatcaagttcaaaagattgcaatgaagatatgaatcaaaaggttaaacccttctcaaacaaactcccatggaagctt |
6299247 |
T |
|
| Q |
201 |
caagagttgaagacccaactcacaggttc |
229 |
Q |
| |
|
||||||||| |||| |||||| ||||||| |
|
|
| T |
6299248 |
caagagttgcagactcaactctcaggttc |
6299276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 40 - 229
Target Start/End: Original strand, 25464221 - 25464410
Alignment:
| Q |
40 |
agaaaatttatgatcttggtggtcgaaaatttgtgatcggtagcattggtccaattgggtgtgccccatcatttattattagaacatcaagttcaaaaga |
139 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||| | |||||||||||| |||||| |||| |||||| || || ||| |||||||||| |
|
|
| T |
25464221 |
agaaaatttatgatcttggtggacgaaaatttgttatcattgccattggtccaatagggtgtatcccagattttattgataaaaactcacgttcaaaaga |
25464320 |
T |
|
| Q |
140 |
ttgcaatgaagatatgaatcaaaaggttaagcccttctcaaacaaactcccatggaagcttcaagagttgaagacccaactcacaggttc |
229 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||| |||||| | |||||||||| ||||||| |
|
|
| T |
25464321 |
ttgcaatgaagatatgaatcaaatggttaagcctttctcaaacaaacttccatggaagcttcgagagttaacgacccaactctcaggttc |
25464410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1430 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: scaffold1430
Description:
Target: scaffold1430; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 35 - 220
Target Start/End: Original strand, 1574 - 1763
Alignment:
| Q |
35 |
tttttagaaaatttatgatcttggtggtcgaaaatttgtgatcggtagcattggtccaattgggtgtgc----cccatcatttattattagaacatcaag |
130 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||| | ||||||| ||||| |||| | ||||| ||||||| || |||||| | |
|
|
| T |
1574 |
ttttcagaaaatttatgatcttggtggacgaaaatttgtgatcattggcattggaccaatcgggtatatatatcccatattttattaataatacatcacg |
1673 |
T |
|
| Q |
131 |
ttcaaaagattgcaatgaagatatgaatcaaaaggttaagcccttctcaaacaaactcccatggaagcttcaagagttgaagacccaact |
220 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| || |||| ||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
1674 |
ttcaaaagattgcaatgaagatgtgaatcaaaagcttaagcctttttcaaccaaactcccatggaagcttcaagagttgaagactcaact |
1763 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University