View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8560_high_40 (Length: 228)

Name: NF8560_high_40
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8560_high_40
NF8560_high_40
[»] chr1 (1 HSPs)
chr1 (1-228)||(26375780-26376006)


Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 228
Target Start/End: Complemental strand, 26376006 - 26375780
Alignment:
1 cttataaaggtttacctgaattttacatacttcttttggnnnnnnngtatatcagattcgtaggaccacggtgtttaattttgcaactgaatttttctct 100  Q
    |||||||||||||||||||||||||||||||||||||||       |||||||||||||||||||| |||||||||||||||||||||||||||||||||    
26376006 cttataaaggtttacctgaattttacatacttcttttggaaaaaaagtatatcagattcgtaggac-acggtgtttaattttgcaactgaatttttctct 26375908  T
101 cttaatttacaggttggatttgggaaatgggaaaactcttgatcttgatcgctgtccccgaccaaagctccgaaaacaatgcataaagtatcttggaccg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
26375907 cttaatttacaggttggatttgggaaatgggaaaactcttgatcttgatcgctgtccccgaccaaagctccgaaaacaatgcataaagtatcttggaccg 26375808  T
201 gtatgtgcatgcatctgtttattggact 228  Q
    ||||||||||||||||||||||||||||    
26375807 gtatgtgcatgcatctgtttattggact 26375780  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University