View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8560_high_42 (Length: 209)

Name: NF8560_high_42
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8560_high_42
NF8560_high_42
[»] chr8 (1 HSPs)
chr8 (119-174)||(39065466-39065522)


Alignment Details
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 119 - 174
Target Start/End: Original strand, 39065466 - 39065522
Alignment:
119 gttaactcacatccctgatacactagttaaaaaacaa-gggtcttgttgaccagtgc 174  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
39065466 gttaactcacatccctgatacactagttaaaaaacaaggggtcttgttgaccagtgc 39065522  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University