View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8560_high_7 (Length: 408)
Name: NF8560_high_7
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8560_high_7 |
 |  |
|
| [»] scaffold0129 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 347; Significance: 0; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 347; E-Value: 0
Query Start/End: Original strand, 18 - 395
Target Start/End: Original strand, 38813834 - 38814209
Alignment:
| Q |
18 |
catgacccttatttaattgcatcttatagagattgaattttaacaaactactatgttctgcgatgcacgatttaatacaaaatattgaccgtgatatccc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38813834 |
catgacccttatttaattgcatcttatagagattgaattttaacaaactactatgttctgcgatgcacgatttaatacaaaatattgaccgtgatatccc |
38813933 |
T |
 |
| Q |
118 |
tattagtttatttggtcgaaatgagggaaagctccgtttcgtggaatcgtgttttgtgaattatccctgtaagtggaagataattttgagatcttcaaat |
217 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38813934 |
tattagtttatttggtcgaaatgcgggaaagctccgtttggtggaatcgagttttgtgaattatccctggaagtggaagataattttgagatcttcaaat |
38814033 |
T |
 |
| Q |
218 |
gatattcggggttcattgtgactactgtcacttcagccattacacaagacgagagactttacaaccgtggagcggctttttgcaaaaagatgagggagaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38814034 |
gatattcggggttcattgtgactactgtcacttcagccattacacaagac--gagactttacaaccgtggagcagctttttgcaaaaagatgagggagaa |
38814131 |
T |
 |
| Q |
318 |
actcagcaatagactatagcagcactttatcactgtagtgtagcagaatatgaacaaacttaatattttccgtgatct |
395 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38814132 |
actcagcaatagactatagcagcactttatcactgtagtgtagcagaatatgaacaaacttaatattttccgtgatct |
38814209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 188 - 386
Target Start/End: Original strand, 39462243 - 39462438
Alignment:
| Q |
188 |
aagtggaagataattttgagatcttcaaatgatattcgggg-ttcattgtgactactgtcacttcagccattacacaagacgagagactttacaaccgtg |
286 |
Q |
| |
|
||||||||||| ||||| |||||||| || ||||||| || |||| ||||||||||||||||| |||| |||| ||||||| |||||| || | | |
|
|
| T |
39462243 |
aagtggaagattatttttagatcttcgaaa-atattcgaggattcaatgtgactactgtcactttggccaatacatttgacgaga--ctttaccacgg-g |
39462338 |
T |
 |
| Q |
287 |
gagcggctttttgcaaaaagatgagggagaaactcagcaatagacta-tagcagcactttatcactgtagtgtagcagaatatgaacaaacttaatattt |
385 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||| || | |||| || |||||||| |||||||||||||||||| | ||||||||| |||||||| |
|
|
| T |
39462339 |
gagccgctttctgcaaaaagatgagggagaaactcagtaagaaactattatcagcacttcatcactgtagtgtagcaggttttgaacaaac-taatattt |
39462437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 49; Significance: 7e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 270 - 322
Target Start/End: Complemental strand, 24499345 - 24499293
Alignment:
| Q |
270 |
gagactttacaaccgtggagcggctttttgcaaaaagatgagggagaaactca |
322 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24499345 |
gagactttactaccgtggagcggctttttgcaaaaagatgagggagaaactca |
24499293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0129 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0129
Description:
Target: scaffold0129; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 52 - 103
Target Start/End: Original strand, 31417 - 31469
Alignment:
| Q |
52 |
gaattttaacaaactactat-gttctgcgatgcacgatttaatacaaaatatt |
103 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| || |||||| ||||||||||| |
|
|
| T |
31417 |
gaatttgaacaaactactattgttctgcgatacaagatttagtacaaaatatt |
31469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University