View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8560_low_44 (Length: 239)
Name: NF8560_low_44
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8560_low_44 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 225
Target Start/End: Complemental strand, 26375597 - 26375370
Alignment:
| Q |
1 |
cacaagcaatctggtgatttatttcatacgaaaaatg---ctgaagatgccaagtggatatttgtaatgagcacctctaagaaactttatgctggcaagg |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26375597 |
cacaagcaatctggtgatttatttcatacgaaaaatgactctgaagatgccaagtggatatttgtaatgagcacctctaagaaactttatgctggcaagg |
26375498 |
T |
|
| Q |
98 |
taacaatttaagctatgtcactgtttcaacttttcaattttctattcaattcaattcaatcctaatatagatacattgtcgtaaccctgcagaaaaagaa |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
26375497 |
taacaatttaagctatgtcactgtttcaacttttcaattttctattcaattcaattcaatcctaatatagatgcattgtcgtaaccctgcagaaaaagaa |
26375398 |
T |
|
| Q |
198 |
gggattatttcatcattcttcctttttg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26375397 |
gggattatttcatcattcttcctttttg |
26375370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University