View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8560_low_48 (Length: 229)
Name: NF8560_low_48
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8560_low_48 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 14 - 184
Target Start/End: Complemental strand, 6915866 - 6915696
Alignment:
| Q |
14 |
agtttggtgttcaataggaagtctatgattgacaatcaacttctcttaatttcaaaccaagctagtttcgttatctcctcttccaattgtagtgtggatt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6915866 |
agtttggtgttcaataggaagtctatgattgacaatcaacttctcttaatttcaaaccaagctagtttcgttatctcctcttccaattgtagtgtggatt |
6915767 |
T |
 |
| Q |
114 |
ctcaatctcattccataggatgtagcattgagatatcttggacacctccaccgcatgatttttacaagatt |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
6915766 |
ctcaatctcattccataggatgtagcattgagatatcttggacacctccaccgcatgattattacaagatt |
6915696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 66 - 171
Target Start/End: Complemental strand, 34868812 - 34868707
Alignment:
| Q |
66 |
caaaccaagctagtttcgttatctcctcttccaattgtagtgtggattctcaatctcattccataggatgtagcattgagatatcttggacacctccacc |
165 |
Q |
| |
|
||||| ||||||||||| ||| ||||||||| ||||||||||||||||||| ||||| || || |||||||||||||||| |||||||||||||| |
|
|
| T |
34868812 |
caaacaaagctagtttcaatattctctcttccaaccgtagtgtggattctcaatcacattcaatgagacgtagcattgagatatcctggacacctccacc |
34868713 |
T |
 |
| Q |
166 |
gcatga |
171 |
Q |
| |
|
|||||| |
|
|
| T |
34868712 |
gcatga |
34868707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University