View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8560_low_50 (Length: 227)
Name: NF8560_low_50
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8560_low_50 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 227
Target Start/End: Original strand, 28457130 - 28457350
Alignment:
| Q |
4 |
acacaattttgttaatggtatctaaaatgctaattgaaaaaggaaaaatatccaagaatgatgctcacccttctggctagccttacgggactatcagtcc |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28457130 |
acacaattttgttaatggtatctaaaatgctaattgaaaaaggaaaaatatcgaagaatgatgctcacccttctggctagccttacgggactatcagtcc |
28457229 |
T |
|
| Q |
104 |
actgaggaagacctgcagcattaatgaaaaattaatgagaaagtgaaataaaataaagcatggggatattattaactgatagtgtctgatacaacctgaa |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||| |
|
|
| T |
28457230 |
actgaggaagacctgcagcattaatgaaaaattaatgagaaagtgaaataaaataaagcatgggga---tattaactgatagtatctgatgcaacctgaa |
28457326 |
T |
|
| Q |
204 |
gatcttccttccttctccttttga |
227 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
28457327 |
gatcttccttccttctccttttga |
28457350 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University