View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8560_low_53 (Length: 203)
Name: NF8560_low_53
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8560_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 168; Significance: 3e-90; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 16 - 183
Target Start/End: Original strand, 43222233 - 43222400
Alignment:
| Q |
16 |
agacaattttagtactgattaaggaattcgctcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtttgc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222233 |
agacaattttagtactgattaaggaattcgctcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtttgc |
43222332 |
T |
|
| Q |
116 |
cattgaaatagactagagacttcctgagagattcccaggcatcagcaagcattggctgaggctcgaac |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43222333 |
cattgaaatagactagagacttcctgagagattcccaggcatcagcaagcattggctgaggctcgaac |
43222400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 20 - 179
Target Start/End: Original strand, 43232654 - 43232809
Alignment:
| Q |
20 |
aattttagtactgattaaggaattcgctcacctgatcataatttagaacttcttctgattgatgatcaacagctgcaagtgtgcctacaggtttgccatt |
119 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| |||||||||||||| |||| |||||||||||||||||||| |||||| |||||| || | |
|
|
| T |
43232654 |
aattttagtactgattaagaaattc----acctgatcgtaatttagaacttcctctgcttgatgatcaacagctgcaattgtgccaacaggtgcacctct |
43232749 |
T |
|
| Q |
120 |
gaaatagactagagacttcctgagagattcccaggcatcagcaagcattggctgaggctc |
179 |
Q |
| |
|
||||| ||||||||| |||||||||||||||||||||||||||| |||||| || ||||| |
|
|
| T |
43232750 |
gaaatggactagagatttcctgagagattcccaggcatcagcaaccattggatgcggctc |
43232809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University