View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8560_low_6 (Length: 451)
Name: NF8560_low_6
Description: NF8560
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8560_low_6 |
 | |
|
| [»] scaffold0740 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0740 (Bit Score: 57; Significance: 1e-23; HSPs: 1)
Name: scaffold0740
Description:
Target: scaffold0740; HSP #1
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 333 - 422
Target Start/End: Complemental strand, 2071 - 1978
Alignment:
| Q |
333 |
agttcctattagcttagaaccctccttgggtagaatttatcctatgattgtgtgagaaaact----agtaagtttatctagtgtatgtttaatt |
422 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
2071 |
agttcctattagtttagaaccctccttgggtagaatgtatgctatgattgtgtgagaaaactactaagtaattttatctagtgtatgttaaatt |
1978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 333 - 369
Target Start/End: Original strand, 20926452 - 20926488
Alignment:
| Q |
333 |
agttcctattagcttagaaccctccttgggtagaatt |
369 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20926452 |
agttcctattagcttagaaccctccttgggtagaatt |
20926488 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University