View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8561_low_11 (Length: 272)
Name: NF8561_low_11
Description: NF8561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8561_low_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 53 - 255
Target Start/End: Complemental strand, 46938453 - 46938251
Alignment:
| Q |
53 |
caccaacaaatgcataatttgcataatcactaccatattcttattaccttgtgccaaatccatccatttagattttccagcagttttcaactttggtgat |
152 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46938453 |
caccaacaaatgcataatttgcataatcactaccatattcttattaccttgtgccaaatccatccatttagattttccagcagttttcaactttggtgat |
46938354 |
T |
|
| Q |
153 |
tcaaattctgataccggcacccttgttaccgctggttttgaaagcctttacccaccaaatggacacacttactttcatctaccatcaggaagatactctg |
252 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46938353 |
tcaaattctgataccggcacccttgttaccgctggttttgaaagcctttacccaccaaatggacacacttactttcatctaccatcagggagatactctg |
46938254 |
T |
|
| Q |
253 |
atg |
255 |
Q |
| |
|
||| |
|
|
| T |
46938253 |
atg |
46938251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 160
Target Start/End: Complemental strand, 46939490 - 46939454
Alignment:
| Q |
124 |
attttccagcagttttcaactttggtgattcaaattc |
160 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46939490 |
attttccagcagttttcaacttaggtgattcaaattc |
46939454 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 160
Target Start/End: Original strand, 36633514 - 36633545
Alignment:
| Q |
129 |
ccagcagttttcaactttggtgattcaaattc |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36633514 |
ccagcagttttcaactttggtgattcaaattc |
36633545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 125 - 166
Target Start/End: Original strand, 37439282 - 37439323
Alignment:
| Q |
125 |
ttttccagcagttttcaactttggtgattcaaattctgatac |
166 |
Q |
| |
|
|||||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
37439282 |
ttttccagcaatattcaactttggagattcaaattctgatac |
37439323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University