View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8561_low_14 (Length: 240)
Name: NF8561_low_14
Description: NF8561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8561_low_14 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 240
Target Start/End: Complemental strand, 31409525 - 31409303
Alignment:
| Q |
18 |
gaaaagggttaaaattgatattttttattgtttttatgtggtaggtataattgttagggcatatggtnnnnnnnnttcaaaaacaa-tagtgaagccagg |
116 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
31409525 |
gaaaagggttaaaattgatatttttgattgtttatatgtggtaggtataattgttagggcatatggtaaaaaat-ttcaaaaacaaatagtgaagccaga |
31409427 |
T |
|
| Q |
117 |
tgttttaaattgtgttgaacaaaaagttgatcacatctacttgtctatgtgagcatctctagttatgatctatgattcaattatttaatttatttaatac |
216 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||| ||||||| | ||||||||||||||||||| ||||||||| |
|
|
| T |
31409426 |
tgttttgaattgcgttgaacaaaaagttgatcatatctacttgtctatgtgagcatctccggttatgagccatgattcaattatttaattcatttaatac |
31409327 |
T |
|
| Q |
217 |
tacttcatctgtcctaaaataatt |
240 |
Q |
| |
|
||||| || ||||||||||||||| |
|
|
| T |
31409326 |
tactttatatgtcctaaaataatt |
31409303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University