View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8561_low_18 (Length: 233)
Name: NF8561_low_18
Description: NF8561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8561_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 6 - 215
Target Start/End: Original strand, 22949759 - 22949968
Alignment:
| Q |
6 |
tcgagtgagatgaacaaaaagagttcactccctatgattcccacaaattaagcaaagctagctatactaactcaaatgagacatatcaactccctctgta |
105 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22949759 |
tcgagtgatatgcacaaaaagagttcactccctatgattcccacaaattaagcaaagctagctatactaactcaaatgagacatatcaactccctctgta |
22949858 |
T |
 |
| Q |
106 |
tacttgaatgtctcggctgcaccaaacttgcaacgttcttcactactttcatcgaattcgtcatcactactatcatcttcttcgtgatcaatagaaggtg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22949859 |
tacttgaatgtctcggctgcaccaaacttgcgacgttcttcactactttcatcgaattcgtcatcactactatcatcttcttcgtgatcaatagaaggtg |
22949958 |
T |
 |
| Q |
206 |
agggaggatt |
215 |
Q |
| |
|
|||||||||| |
|
|
| T |
22949959 |
agggaggatt |
22949968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University