View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8561_low_19 (Length: 228)
Name: NF8561_low_19
Description: NF8561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8561_low_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 45313814 - 45314052
Alignment:
| Q |
1 |
ccaaagaaacaaacccaaatttcaattttttcataggagccttatcaacatta-----------------tccaaaatgctaaaatcatcaggatttatc |
83 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
45313814 |
ccaaagaaacaaacccaaatttcaattttttcataggagccttatcaacattagaaattgccctatcctatccaaaatgctaaaatcatccggatttatc |
45313913 |
T |
|
| Q |
84 |
tcaggaaactcactgagaagcatcaacaacatcaatgacggaagatggaagcggtgggtcatccggcggagtgtgaaaaacgtcttggttatcgacgtgc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45313914 |
tcaggaaactcactgagaagcatcaacaacatcaatgacggaagatggaagcggtgggtcatccggcggagtgtgaaaaacgtcttggttatcgacgtgc |
45314013 |
T |
|
| Q |
184 |
tgggtgtctggagcggacaagaggatgacgggagggatg |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45314014 |
tgggtgtctggagcggacaagaggatgacgggagggatg |
45314052 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 114 - 222
Target Start/End: Complemental strand, 54631353 - 54631245
Alignment:
| Q |
114 |
atcaatgacggaagatggaagcggtgggtcatccggcggagtgtgaaaaacgtcttggttatcgacgtgctgggtgtctggagcggacaagaggatgacg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| | |
|
|
| T |
54631353 |
atcaatgacggaagatggaagcggtgggtcctccggcggagtgtgaaaaacgtcttggttatcgacgtgctgggtgtctggagcgtacaatgggatgatg |
54631254 |
T |
|
| Q |
214 |
ggagggatg |
222 |
Q |
| |
|
||||||||| |
|
|
| T |
54631253 |
ggagggatg |
54631245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University