View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8561_low_23 (Length: 218)
Name: NF8561_low_23
Description: NF8561
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8561_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 116
Target Start/End: Original strand, 7470487 - 7470602
Alignment:
| Q |
1 |
tattcacataggcaagtgtgagaatgtttgggaaggtttaagaaaactgcttatggcatatctataagttattttcaacttattttcgtaagccctccaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7470487 |
tattcacataggcaagtgtgagaatgtttgggaaggtttaagaaaactgcttatggcatatctataagttattttcaacttattttcgtaagccctccaa |
7470586 |
T |
|
| Q |
101 |
gacatgcttataactt |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7470587 |
gacatgcttataactt |
7470602 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 114 - 218
Target Start/End: Original strand, 7470630 - 7470734
Alignment:
| Q |
114 |
cttttgtcgcagaaatagtttttatactataagtactttgagttgtttactcaaacatggtcttaatacatgaagttgttggtaatggttgcagaatatc |
213 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
7470630 |
cttttgtcgtagaaatagtttttatactataagtactttgagttgtttactcaaacatggtcttaatacatgaagctgttgataatggttgcagaatatc |
7470729 |
T |
|
| Q |
214 |
aggcc |
218 |
Q |
| |
|
||||| |
|
|
| T |
7470730 |
aggcc |
7470734 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 42 - 86
Target Start/End: Original strand, 29768627 - 29768671
Alignment:
| Q |
42 |
gaaaactgcttatggcatatctataagttattttcaacttatttt |
86 |
Q |
| |
|
|||||| ||||||| ||| |||||||| ||||||||||||||||| |
|
|
| T |
29768627 |
gaaaacggcttatgacatgtctataagctattttcaacttatttt |
29768671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 85
Target Start/End: Complemental strand, 23819196 - 23819128
Alignment:
| Q |
17 |
tgtgagaatgtttgggaaggtttaagaaaactgcttatggcatatctataagttattttcaacttattt |
85 |
Q |
| |
|
||||||| ||||||| | |||||||||||| ||||||| ||| || ||||||| |||||| ||||||| |
|
|
| T |
23819196 |
tgtgagactgtttggaagagtttaagaaaacagcttatgacatgtccataagttgttttcatcttattt |
23819128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University