View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8562_low_5 (Length: 239)
Name: NF8562_low_5
Description: NF8562
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8562_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 33840559 - 33840775
Alignment:
| Q |
1 |
tcaaattcaactctcaacaaattttctccaccgcgttataaatttgcacactatatgtcatgcaaaagcatccctcataatacatacatggcagtattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33840559 |
tcaaattcaactctcaacaaattttctccaccgcgttataaatttgcaaactatatgtcatgcaaaagcatccctcataatacat-----gcagtattaa |
33840653 |
T |
|
| Q |
101 |
ttattttaagccacctaatgcaaaacaagacnnnnnnncatataaataaggtactagaaaacaaataactagccattgattttgtggagacacatggctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
33840654 |
ttattttaagccacctaatgcaaaacaagacaaaaaaacatataaataaggtactagaaaacaaatagctagcctttgattttgtggagacacatggctt |
33840753 |
T |
|
| Q |
201 |
gtttctgctttcttgttgatca |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33840754 |
gtttctgctttcttgttgatca |
33840775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University