View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8563_low_14 (Length: 321)
Name: NF8563_low_14
Description: NF8563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8563_low_14 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 302
Target Start/End: Complemental strand, 2821532 - 2821231
Alignment:
| Q |
1 |
gaaaaggcaaagaaaacggcgcattttaggttggtggtaaaaaatggaaaagggtatttagagaaatacaagaacaaagaagctatacaaacacgtgatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2821532 |
gaaaaggcaaagaaaacggcgcattttaggttggtggtaaaaaatggaaaagggtatttagagaaatacaagaacaaagaagctatacaaacacgtgatg |
2821433 |
T |
 |
| Q |
101 |
ttttcaccgtttggggtattctgcaattactgagaaagtaccctggtaaaattccagacttggaactcatgtttgattgcaatgataagcctgttgtgcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2821432 |
ttttcaccgtttggggtattctgcaattactgagaaagtaccctggtaaaattccagacttggaactcatgtttgattgcaatgataagcctgttgtgcc |
2821333 |
T |
 |
| Q |
201 |
cattggcttggacccaccacctgtttttggttactgtgctgatcggtggacacaagatattgttttccctgactggtccttctggggttggtatgttcct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2821332 |
cattggcttggacccaccacctgtttttggttactgtgctgatcggtggacacaagatattgttttccctgactggtccttctggggttggtatgttcct |
2821233 |
T |
 |
| Q |
301 |
aa |
302 |
Q |
| |
|
|| |
|
|
| T |
2821232 |
aa |
2821231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 112 - 197
Target Start/End: Original strand, 11808810 - 11808895
Alignment:
| Q |
112 |
tggggtattctgcaattactgagaaagtaccctggtaaaattccagacttggaactcatgtttgattgcaatgataagcctgttgt |
197 |
Q |
| |
|
||||||||| |||||||| ||||| ||||||||| || | || || |||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
11808810 |
tggggtattttgcaattattgagattgtaccctggcaagttgcctgatttggaacttatgtttgattgtgaagataagcctgttgt |
11808895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University